A Critical Ayurvedic Perspective on Madatyaya (Alcoholism) - Juniper Publishers

 Addiction & Rehabilitation Medicine - Juniper Publishers

Abstract

Alcohol abuse is one of the genuine social issues which is quickly expanding consistently. The quickest development is being seen in the non-industrial nations of Asia, more especially in India. Drinking of alcohol makes the existence of a man truly hopeless, alcohol debases the wellbeing of the individual as well as influences his family and society. Alcohol abuse is named as Madatyaya in Ayurveda, which is one among the way of lifestyle disorder, is additionally impairing habit-forming jumble. It has expanded at a disturbing rate around the world, even in India it is an issue of concern. The ailments caused by Madya in Mithya, Atiyoga and Heenayoga can be cured by taking the Madya in proper way and proper quantity (Samayoga). The classics of Ayurveda narrate this disease Madatyaya with its types, symptoms and treatment. Excessive consumption of Madya directly affects ‘Hridaya’, which is one of the vital organs of body and it is mainly associated with the Rasavaha srotas, Manovaha Srotas and oja. So, we are trying to describe effect of Madatyaya on human body.

Keywords: Madatyaya; Alcohol; Madya; Ayurveda; Alcoholism

Introduction

In Ayurvedic text alcoholism and its withdrawal are described under the heading of Madatyaya and makes Ayurveda very much capable to treat this condition [1]. In charak samhita Madya Varga classified under one of 12 Ahara Varga. It is utilized as Ahara Dravya (Food Supplement), as Anupana (After Drink) or as aushadhi (Medication). Based on use, Madya is categorized into two kinds as medication and as beverage. In Ayurveda based on techniques and natural substances used name of different preparations are: Asava, Arishta, Sura, Varuni and Sidhu. Out of these, initial two are utilized for medication and others for refreshment.

Madya is one which produces Mada. When given in appropriate amount, in time and in proper system, it brings joy, strength, lessens dread, strain. Furthermore, act as an Amrut (Nector) for the body [2]. The patient who has tamas and rajas manas prakruti will easily habituate for alcohol than satvik manas prakriti and vice-versa. In the absence of alcohol, continuous demand of it felt which is known as Panapkrama (Alcohol Withdrawal Syndrome) [3].

Review of Literature

i.Madatyaya has been explained in 24th chapter of Charaka Samhita after VishaChikitsa, in light of the fact that Madhya is having properties like Visha (poison). Charaka clarifies the Madhya Gunas (characteristics), phases of Madatyaya (Alcoholism), liquor addiction, their signs, side effects and Chikitsa (treatment).

ii.In Sushruta Samhita, UttaraTantra 47th chapter, Acharyas portrayed with regards to Madatyaya exhaustively for the sake of Panatyaya Pratisheda.

iii.In Astanga Samgraha, Madatyaya Chikitsa has been mentioned in ninth chapter of Chikitsa Sthana. It specifies Madhya Prayoga in Madatyaya and mentioned the treatment of Mada and Murcha.

iv.In Astanga Hrudaya, Nidana (causative factors) of Madatyaya has been clarified in sixth chapter of Nidan sthana, and in seventh chapter of Chikitsasthana the treatment of Mada (inebriation), Murcha (syncope), Sanyasa (unconsciousness) including Nidana (etiology), and Chikitsa (treatment) of Dwamsaka and Vikshaya has been clarified.

v.In Chikitsastana of Kashyapa Samhita, the author has clarified impacts of Madhya in pregnant ladies and newborn children with their treatment.

vi.In Madhava Nidana, Madatyaya is explained after Krumi Nidana.

vii.In BhavaPrakash, Madatyaya is clarified in Madyama Khanda after Murcha, Bhrama, Nidra,Tandra and Sanyas Adhikarna, trailed by DahaAdhikarana.

viii.Yogaratnakar has clarified a different chapter as Madatyaya Adhikara after Murchadhikara [4].

Effect of Madya

Madya incorporates Tridosha, Rasa and Rakta as dushya and Rasavaha, Raktavaha, Sangyavaha Shrotas. Hridaya is the principle adhisthan because of which people experience the ill effects of Ojakshaya, Dhatukshaya, Sharirkampa, Pralapa, Bhrama, AgniVikar, Anidra etc.

a. Madyaavastha (Acute Intoxication)

Acute intoxication is usually a consequence of deliberate heavy drinking either small doses at short intervals, or a large dose at a time.

b. Prathama Avastha (Stage of excitement)

The individual goes overthrill, enthusiastic, appropriate appearance of the traits of food and drink, and the insight and inventiveness of music, tune, humor and stories. This outcomes in strong rest and post-waking sensations. Subsequently, this phase of inebriation is conductive to joy [5].

c. Madhyama Avastha (Stage of in-coordination)

The individual frequently recalls things and regularly fails to remember them, his voice becomes unintelligible and confounded, and he talks sense and babble simultaneously. His development, pose, drinking, eating and talking all are improper [6].

d. Antima Avastha (Stage of narcosis)

Subsequent to intersection of second stage and in the start of the third stage, people become dormant like a messed up tree with his psyche tormented with inebriating morbidities and obviousness. However alive, he looks like dead individual. He becomes unequipped for perceiving satisfying things and companions. He was deprived of all joy for which he had taken liquor. He loses every sense of qualification of legitimate, cheerful and helpful things from some unacceptable, hopeless hurtful ones separately; along these lines, no shrewd individual will at any point prefer to put himself in such a phase of inebriation. He is denounced and reproached by all people and disdained by them. As the normal result of this extravagance, he experiences agonies and infections constantly [7].

e. Chronic Intoxication

Habitual drunkards are either psychotic or neurotic and usually take alcohol as a mean to escape from the stress and strains of life. They have been taking alcohol for a long and continued period.

f. Madatyaya

Madatyaya comprises of two words Mada and Atyay. Mada implies Harsh (Sense of wellbeing) Atyay implies Atikrama (excess). The excess intake of Madya cause poisonous impacts. Poisonous impacts depend upon the prakruti and dosh of the person [8,9]. In Sharangadhara Samhita while characterizing the term Madakari, Madhya is included in the drugs having Tamoguna predominently causes insanity are known as Madakari (intoxicants) [10].

Types of Madatyaya

Madatyaya is Tridoshaja vyadhi. Its types named on Dosha which is dominating in presenting the symptoms. Charak explains types of Madatyaya as Vataja, Pittaja and Kaphaja and considers the disease as Tridoshaja.

a. Vataja Madatyaya

Nidana: If a person is excessively emaciated because of Krodha, Shoka, Bhaya, Vyavaya, Chankramana, Sahasa, while eating Ruksha type of food, less quantity of food or limited quantity of food, drinks Madya at night which is excessively fermented, then this leads to the impairment of his Nidra and Vataja type of Madatyaya instantaneously develops [11].

b. Pittaja Madatyaya

Nidana: If a person, indulging in food that is Amla, Ushna and Teekshņa, having wrathful disposition and having likeing for excessive exposure to the fire and sun, drinks excess quantity of Madya that is Teekshna, Ushna and Amla, then he suffers from the Pittaja type of Madatyaya [12].

c. Kaphaja Madatyaya

Nidana: If a person who is habituated to Madhura, Snigdha and Guru Ahara, who does not perform Vyayam, who takes Diwaswapn and who indulges in Sukhaseenata, excessively drinks Madya which is not an old one or which is prepared of Guda, and Paishtika, then he immediately develops Kaphaja Madatyaya [13].

Upadrava of Madatyaya

Hikka associated with Jwara, Vamathu, Vepathu, Parshwashoola, Kasa and Bhrama [22].

Asadhya Lakshna

The following are the characteristics of Asadhya Lakshana: Heenottaraushitam, Atisheetam, Amandadaaham,Tailaprabhaasyam,Jihvaushtiha,Dantamasitam, Vaaneel and Peetanayana rudhirataa [23].

General Line of Treatment

All types of madatyaya are tridosaja.Treatment should be based on the dominant dosas.However,most of the time treatment is started for kapha dosa as pitta and vayu are manifested towards the end in most of the cases of madatyaya [24].

a. Counselling

i.Motivational counselling

ii.Group counselling

b. RelaxingTherapies: Musictherapy,Siropichu,Sirodhara,Ppadabhyang,Takradhara.

c. Padanshik Chikitsa Madya used in small amount or tapering doses.

d. Shodhana Chikitsa

i.If fit for Vamana- Sadyo vamana with Yastimadhu Phanta and Saindhava jala.

ii.If unfit for Shodhana- symptomatic treatment.

e. Shamana Chikitsa

Single drugs used

i.Brahmi

ii.Ashwagandha

iii.Bhringaraja

iv.Kushmanda

v.Jatamansi

vi.Shankhapushpi

vii.Mandukparni

viii.Guduchi

Discussion

Alcohol whenever taken in appropriate way, time, with healthy food, in ideal proportion, as per own solidarity then it is pretty much as advantageous as Amrita. Generally, 80 % alcohol assimilate in small digestive system and significantly more utilized in liver that is the reason it shows its poisonous impact on liver and damages it. According to Ayurvedic texts Madatyaya has clinical manifestations like alcoholism. For any illness fundamental causative variables are unevenness of Dosha and Dushya. So, drug having Tridosha shamak impact, and which increases oja, bala, dhatu, having deepana, pachana, anulomana, yakrita uttejak, mutral, raktavardhak, raktashodhak, vishaghna, rasayan, medhya, hepatoprotective properties can be used judiciously for madatyaya.

In this way, Madatyaya described in Ayurveda can be correlated with chronic alcoholism and its complications upto some degree. Ayurveda has a unique understanding of human physiology and pathology, diagnosis and treatment. On sudden abstinence of alcohol, agni which maintains the equilibrium of the body gets altered, leading to the formation of ama. The ama causes srodhorodha (blockage of circulatory channels) and results in deficit of bala. The anulomana property of vata gets derranged and affects the functions of the body as well as mind. As we know that Madya for Madataya is the main Chikitsa Sutra mentioned in Ayurveda, play an important role in Alcohol Withdrawal, as sudden withdrawal may cause serious complication.

Madya which is used should be made up of particular medicinal herbs and given in tapering doses. Such a protocol seems safe as well as effective in the management of Alcohol withdrawal syndrome. Hence it is important to know the properties of Madya for understanding its effect on the body. It will be useful to minimize its hazardous action and in treating disease.Charaka Samhita discussed different formulations as per type of Madatyaya are Kharjooradi Mantha, Punarnavadi Ghrita, Ashtanga Lavana etc. It also quotes the Complications of untreated Madatyaya.

Conclusion

Subsequently, it is concluded that Madatyaya is well explained in Ayurveda, which helps in diagnosis and management depending on the involvement of the Dosha. Charak’s view towards alcoholism has great value because of its scientific literature study and description of physical & mental characteristic symptoms. Ayurveda also accept that it is cardiotoxic as well as dependent drug. Symptoms of pittaj madatyaya may be compared with alcoholic hepatitis. Concept of alcoholic addiction may be high lightened in terms of Dhwansaka & Vikshay. The chronic alcoholism may be compared with Pan Vibhram as mentioned. If we review & compare entire views of all Acharyas we can come to certain concrete conclusions regarding Madatyaya and its causes, symptoms, pathophysiology & excellent line of treatment that has been elaborately explained by Acharya charak and put intense light on the same, more effectively than other classical texts of ancient time.

The Ayurvedic management protocol along with the rehabilitation measures are effective in alleviating the symptoms of Alcohol withdrawal and associative conditions. Shamana therapy or even Shodhana therapy can be administered as per the severity of the condition of the affected person. One need to be careful in selection of appropriate procedure as it is based on Rogi and Roga Bala. Thus Ayurveda have ultimate and effective solution in the management and rehabilitation of madatyaya.

To Know more about Addiction & Rehabilitation Medicine

Click here:  https://juniperpublishers.com/gjarm/index.php

To Know more about our Juniper Publishers

Click here: https://juniperpublishers.com/index.php 

Cyperus Rotundus and its Anti-Obesity Effect in Swiss Albino Mice - Juniper Publishers

 Annals of Reviews and Research - Juniper Publishers

Abstract

Cyperus rotundus also known as ‘Nutgrass’ have been used in Ayurveda and in Traditional Chinese medicinal practices for its multiple medicinal property. Since obesity is major factor for the increase in the metabolic syndrome related complication. We have used Cyperus rotundus methanolic extract in mice along with the High fat diet. As compared to only high fat diet group, Cyperus rotundus administered high fat diet showed significant weight reduction along with reduced triglycerides and cholesterol level. Cyperus rotundus also acted on inflammation, reducing the TNF alpha level in mice fed with Cyperus rotundus along with the high fat diet. This was also connected to the level of reduction in the mRNA expression of COX-2 in the visceral fat of the mice.

Keywords:  Cyperus rotundus; Anti-obesity; Ayurveda; Herbal plant; TNF-alpha, Anti-inflammatory; Hypolipidemic

Abbreviation:HFD: High fat diet; CRR: Cyperus rotundus roots; TNF: Tumor necrosis factor; COX: Cyclo-oxygenase; BW: Body weight

Introduction

Obesity is a public health problem in both developed and underdeveloped countries. It might be owing to the complex interaction of genetic, nutritional, behavioural, and environmental variables that contribute to morbidity and death. In other words, it is produced by a higher calorie intake than expenditure. Obesity is commonly characterised as an abnormal or excessive quantity of fat build-up, to the point where it has a negative impact on health. Obesity pathogenesis promotes the development of metabolic illnesses (e.g., Type 2 diabetes, fatty liver disease, hypertension, hyperlipidaemia, osteoarthritis, cancer, low-grade inflammation, sleep apnea, and cardiovascular disease) [1]. Obesity's complicated pathophysiology necessitates the discovery and development of novel medications and solutions for its prevention or treatment. Because present medications are failing to provide long-term treatments, natural items, particularly medicinal herbs, are thought to be viable antiobesity agents. Different natural product combinations work synergistically on multiple molecular targets via diverse ways, either boosting weight reduction or avoiding weight gain [2]. Medicinal plants' mechanisms for combating obesity include inhibition of lipid hydrolysing and metabolising enzymes, disruption and modification of adipogenic factors, and appetite suppressants [3].

Anti-obesity mechanism of Cyperus rotundus

Cyperus rotundus has numerous medicinal properties which include anti-cariogenic, anti-viral activity, anti-Candida, cytotoxic effect, inhibition of Brain Na+ K+ ATPase, neuroprotective effect, anti-emetic, anti-arthritic, hypotensive, cytoprotective, cardioprotective, anti-hyperlipidaemic, anti-malarial, anti-allergic, hepatoprotective, anti-histamine, ovicidal and larvicidal effect, gastroprotective, anti-helmintic, analgesic, anti-ulcer anti-platelet, anti-obesity, anti-convulsant, anti-microbial, anti-hyperglycaemic, anti-diarrheal, anti-inflammatory, anti-pyretic, wound healing, anti-oxidant property [4]. Cyperus rotundus is a perennial herb native to India, used to treat various ailments such as diarrhoea, diabetes, pyrosis, inflammation, malaria, bowel disorder, cancer, hypertension, and allergy . The major organic chemicals isolated from various parts of the Cyperus species include quinonoid pigments, sesquiterpenoids, flavonoids and stilbene derivatives [5]. Several monoterpenoids, amino acids and fatty acids are also reported in the plant. The ethyl acetate extract of dried, pulverized rhizomes of C. rotundus was reported to contain Scirpusin A, Scirpusin B & Piceatannol as major compounds [6]. The chloroform/methyl alcohol extraction of C. rotundus yielded novel enantiomeric and meso-stilbene trimers, such as Cyperusphenol A as well as other stilbenoids (Cyperusphenol C & D, Scirpusins A & B, Piceid and Luteolin [7].

Materials and Methods

Extraction: The Roots of Cyperus rotundus L. were purchased from local market and its authenticity was done by Prof. NK Dubey and the voucher has been preserved in Centre of Advanced study in botany Herbarium and in our department under voucher no. Cypera.2021/4 and YBT/MC/2021/4 respectively as dry material. It was dried in sun light and coarse powder was made. This powder was filled in a thimble of blotting paper and put in Soxhlet apparatus for extraction. For the preparation of total methanol extract CRR (Cyperus rotundus roots), the powder CRR were extracted with methanol separately in Soxhlet extractor for 30 hrs. For extract preparation, weighed the amount of sample was refluxed in round bottom flask by two hours on water bath. The solvent was filtered out and the process was repeated two times. The solvent from all these steps were collected and distilled in vacuum distillation plant. The solvent free extract was prepared by drying the solvent on water bath and by desiccation in the vacuum desiccation till constant of the weight. Animals: Animals were procured from the central animal facility of our own Institute. They were inbred animals of Swiss albino mice. The animal tests were carried out in accordance with the ethical clearance committee of Banaras Hindu University's Institute of Medical Sciences. Varanasi, India. The study in this research work were approved vide letter no. Dean/2021/CAEC/2567 dated 07.03.2021. Anesthesia: Experiments were carried out on healthy adult male albino mice of the Swiss albino strain weighing between 15-20 gm. and kept in our animal facility for 7 days, on animal food and water ad libitum, for deworming and acclimatization in a controlled condition of room temperature, humidity (50 percent RH), and light (12 hr:12 hr light dark period).

Preparation of High fat diet

It contained lard (177.6 g/lit) Casein (200gm/lit) L-cysteine (3gm/lit), Corn starch (72.8gm) Maltodextrin(100gm/lit), Sucrose (172.8gm), Soyabin oil (25gm) Reagents: SGPT, SGOT <Glucose estimation were purchased from Accurex Biomedical Pvt. Ltd., Thane, India. Lipase substrate, 4-nitrophenyl butyrate, DPP-4 substrate and ABTS+ tablet was purchased from sigma -aldrich. Tnf-alpha Elisa kit was purchased from Elabscience, USA Nitroblue tetrazolium chloride, Metaphospheric acid (HPO3)n, Methiionine, Riboflavin were purchased from Hi-Media, Calcutta, Hemocord-D, a hemoglobin reagent was purchased for Coral Clinical system, Goa, India

Methods

To induce obesity twelve healthy albino mice of Swiss strain of inbreed colony (weighing 20-30 gm) were randomly divided in to 2 groups of 6 individual (n=6). Each of which was designated as control (C) was kept on normal diet and other was supplemented with high fat diet Above treatments were continued for 4 months. This group contained 6 mice.

For the effect of CRR on the HFD fed mice we divided the groups under 4 groups.

i. Standard Diet (Chow diet )

ii. High fat diet (45 %kcal)

iii. High fat diet (45 %kcal)+ 750mg/kg CRR Extract.

iv. High fat diet (45 %kcal)+ 1500mg/kg CRR Extract.

v. High fat diet (45 %kcal)+ 3000mg/kg CRR Extract.

Estimation of Body weight -Body weight was taken every 10^th day in the duration of 60 days. The weight was taken 3 times and its average was considered.

Estimation of serum cholesterol-10 ul of serum was combined into 1 ml of working solution and incubated for 5 minutes at 370C or 10 minutes at room temperature (25-300C). After incubation, the absorbance of the assay mixture is measured at 510 nm in comparison to a blank. If not exposed to direct light, the finished colour remains consistent for 2 hours.

i. Calculation: Conc. (mg%) = Absorbance of sample/Absorbance of standard ×200

Determination of Serum glucose: 10 μl of serum was combined into 1 ml of working solution and incubated for 10 minutes. The finished colour will remain steady for at least 1 hour.

i. Calculation: Conc. (mg%) = Absorbance of sample/Absorbance of standard ×200

Oral Glucose Tolerance Test (OGTT): In overnight fasted mice, oral glucose tolerance tests (OGTTs) were performed. Following a minor tail incision, blood samples for glucose measurement were collected. The concentrations of glucose in the blood were measured using a glucometer (SD-Chek India) at 0, 15, 30, 45, and 60 minutes following an oral dose of glucose (2 g/kg body weight dissolved in 0.9 percent saline solution

Estimation of SOD activity: 1.25 ml of SOD buffer (pH 7.8), 600 l methionine, 150 l EDTA, 300 l NBT, 200 l riboflavin, and 500 l of properly diluted tissue homogenate were included in the 3 ml reaction mixture. The percentage inhibition was determined in relation to the control (without the enzyme source).

Estimation of catalase: 2.0 ml of diluted homogenate in 0.1M phosphate buffer was added to the reaction mixture (enzyme extract). To begin the reaction, 1.0 ml of 200 mM H₂O₂ was added. The reduction in OD per minute was measured against a blank (all reagents except enzyme extract) for 3 minutes at 240 nm at 15-second intervals.CAT activity was expressed as mg/ protein in tissue and was calculated as follows: U/mg protein = ΔA/min ×Total reaction mixture volume/Sample Volume × E × protein (mg/ml) X DF

Estimation of Lipid Peroxidation (LPO): 1.5 ml of 10% TCA solution was added to 100 l of tissue homogenate. After 10 minutes, spin at 5000 rpm for 10 minutes. The supernatant was separated and combined with 1.5 mL of TBA. The tubes were placed in a boiling water bath for 30 minutes to finish the reaction before being cooled with tap water. The absorbance of the sample at 535nm in comparison to distilled water.

i. Calculation: MDA (nmol) = Concentration of Standard TEP (nm) × Experimental OD /Absorbance of standard TEP

Estimation of TNF alpha: Mouse TNF- alpha was estimated through ELISA kit ,the assay procedure for it was followed as per the Manufacturer protocol

Estimation of COX-2: Reverse transcriptase PCR of visceral fat tissue was used. RNA isolation was done with the Trizol reagent. The CDNA was prepared with the GAPDH Primer Forward Primer 5’CACGGCAAGTTCAATGGCACA 3’and reverse primer GAATTGTGAGGGAGAG TGCTC as constitutive gene and COX-2 forward primer 5’ TGGGTGTGAAGGGAAATAAGG 3’, reverse primer 5’CATCATATTTGAGCCTTGGGG 3’.

Results

Estimation of Body weight- In the 60 days study, there were significant differences in body weight among the normal diet, HFD groups and CRR groups. The increase in the body weight was observed after 20 days in the significant manner with the p<0.05. The HFD group gained the weight in the course of 60days. In contrast the CRR fed HFD mice showed stagnant increase in body weight (Figure 1).

Estimation of Lipid profile

The administration of HFD and Normal diet in mice shown the increment in both TG and Cholesterol percentage during the 60 days. In HFD group the TG percentage of the mice on 60^th day was 60.85 ±0.49 which was increased by 1.09 times as compared to normal fed mice of the 60^th day having its value of 60^th day of 55.66 ± 1.17. Effect of HFD shown the significant increase in Triglyceride level. In Normal diet fed group the cholesterol percentage of the mice was 50.83±0.45 on 60th day and HFD group shown the 55.51%+ 0.51 cholesterol percentage on 60^th day. Cholesterol level was increased by 1.09 times in the HFD group as compared to Normal diet fed mice The administration of HFD along with the CRR in mice shown the increment in both TG and Cholesterol percentage during the 60 days, but it was significantly reduced as compared to HFD diet. In HFD group the TG percentage of the mice on 60^th day was 60.85 ±0.49 which was increased by 1.09 times as compared to normal fed mice of the 60^th day having its value of 60^th day of 55.66 ± 1.17. Effect of HFD shown the significant increase in Triglyceride level. Cholesterol percentage during the 60 days was also significantly increased in HFD group as compared to Normal fed mice. In Normal diet fed group the cholesterol percentage of the mice was 50.83±0.45 on 60^th day and HFD group shown the 55.51%+ 0.51 cholesterol percentage on ^0th day. Cholesterol level was increased by 1.09 times in the HFD group as compared to Normal diet fed mice (Figure 2).

Effect of CRR on HFD fed mice on antioxidant enzyme activities in blood hemolysate:

The SOD and catalase activity were decreased in HFD fed mice group in gradient manner. Significant reduction in SOD level was observed from 30 days onwards to 60 days i.e from (0.419 ± 0.017) to (0.233 ± 0.014) (p<0.005). SOD level from 30 days to 60 days was downregulated by 1.8 times in HFD group. In contrast, Normal diet fed mice (NFD) group shown no significant changes in SOD. Comparing the NFD group of 60 days to HFD group of 60 days there was downregulation of SOD by 2.0 times (0.458± 0.02 to 0.233± 0.014). In catalase, the NDF group there was no significant changes in catalase from 10 to 60 days. In HFD, significant change was observed from its basal value . The changes were statistically significant (both P<0.05). The decrease in catalase was observed on 10th to 60^th day in gradual manner .In comparison of HFD to NFD ,the mice on 60^th day shown the catalase value of (0.388 ± 0.08) as compared to NFD mice (1.277 ± 0.029) .In the estimation of Plasma LPO , there was no significant change in NFD group but in the HFD group there was significant increase in plasma LPO as compared to its basal value and also with the 30 days (p<0.001). At 60 days in HFD group the mean levels of TBARS reached to 0.579 nmol/mg protein which was significant higher compared with their baseline and 60 days NFD mice (p<0.001) The ABTS+ scavenging potential in HFD group was also decreased in this period when compared with NFD group. It was significantly (p<0.001) declined on the 60^th day. Thus, it could be suggested that changes in activity of SOD, catalase and ABTS+ scavenging potential are some of the sensitive parameters for early detection of HFD feeding related metabolic changes (Figure 3).

Estimation of TNF alpha- HFD fed mice (Figure 4)

Estimation of COX-2

The COX-2 mRNA expression in visceral fat was significantly higher in high fat diet fed mice group on the 60^th day. In comparison to HFD, the CRR fed in HFD mice i.e HFD+3000mg/kg BW showed the significant reduction in the level of mRNA expression of COX-2. Group 3- HFD+ 750mg/kg BW CRR, and HFD+1500mg/kg BW CRR also reduced the COX-2 expression as compared to HFD (Figure 5 & 6).

Conclusion

Since The state of obesity can trigger the occurrence of oxidative stress conditions due to prooxidant and antioxidant imbalance in the body so that it will form Reactive Oxygen Species (ROS) [8]. Obesity occurs excessive lipogenesis and inhibition of lipolysis [9]. Lipogenesis is stimulated by a diet high in carbohydrates. The major antioxidant enzymes that neutralise Reactive Oxygen Species (ROS) are superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPx). SOD catalyses superoxide dismutase into H₂O₂ and oxygen, whereas CAT and GPx neutralize H₂O₂. Finally, high ROS production and decreased antioxidant capacity lead to a variety of disorders, including endothelial dysfunction, characterised by decreased endothelial vasodilation and systemic RBC bioavailability [10]. In the state of obesity can occur chronic inflammatory conditions of low levels with progressive infiltration of immune cells in obese adipose tissue [11]. Cytokines secreted by immune cells and adipokines of adipose tissue promote tissue inflammation [12]. The administration of CRR in 750mg/kg BW ,1500mg/kg BW and 3000mg/Kg BW in HFD fed mice for 60 days showed the reduction in all biochemical parameters. Dose of 3000mg/kg BW of CRR in HFD fed mice significantly reduced the triglycerides and cholesterol level. As CRR have earlier shown its property as antioxidant, in the blood hemolysate it showed the quenching of free radicle which are being produced in the presence of HFD [13]. This quenching could be the enhancement in antioxidant mechanism such as SOD ,Catalase and ABTS+. In our antioxidant test, gradual increase in the SOD, Catalase and ABTS+ defence mechanism was improved significantly. Similarly, lipid peroxidation (LPO) was reduced in CRR fed mice of HFD. This indicates that CRR in these HFD fed mice, managed to maintain the equilibrium of lipid metabolism. In the visceral fat study, as CRR have earlier been reported as TNF-alpha inhibitory [14], this could explain the inhibition of VEGF, as TNF-alpha action on adipocytes can directly alter lipid metabolism through inhibition of FFA uptake and lipogenesis and stimulation of FFA release via lipolysis [15]. In this way, adipose tissue-derived TNF-α can contribute to the development of dyslipidaemia and resultant metabolic complications [16]. In this experiment we have seen that COX-2 level have also been reduced in increasing order of CRR concertation in the HFD fed mice. Henceforth it can be concluded that CRR shows its activity as antioxidant which in results causes downregulation of inflammatory cytokines such as TNF alpha and COX-2. Due to this, histology of visceral fat fad of CRR fed mice showed the smaller size of adipocytes as compared to HFD. All these cascading results of CRR in the obese mice, could be utilised as anti-obesity plant.

To Know more about Annals of Reviews and Research

Click here:  https://juniperpublishers.com/arr/index.php

To Know more about our Juniper Publishers

Click here: https://juniperpublishers.com/index.php